|
ATCC
humanized monoclonal anti human cd26 cdna Humanized Monoclonal Anti Human Cd26 Cdna, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/humanized monoclonal anti human cd26 cdna/product/ATCC Average 90 stars, based on 1 article reviews
humanized monoclonal anti human cd26 cdna - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
human dpp4 fragments ![]() Human Dpp4 Fragments, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human dpp4 fragments/product/New England Biolabs Average 99 stars, based on 1 article reviews
human dpp4 fragments - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
OriGene
dipeptidyl peptidase 4 dpp4 cdna clones ![]() Dipeptidyl Peptidase 4 Dpp4 Cdna Clones, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dipeptidyl peptidase 4 dpp4 cdna clones/product/OriGene Average 92 stars, based on 1 article reviews
dipeptidyl peptidase 4 dpp4 cdna clones - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
OriGene
human dpp4 ![]() Human Dpp4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human dpp4/product/OriGene Average 90 stars, based on 1 article reviews
human dpp4 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
OriGene
untagged mouse ms dpp4 plasmid pcmv kan neo msdpp4 ![]() Untagged Mouse Ms Dpp4 Plasmid Pcmv Kan Neo Msdpp4, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/untagged mouse ms dpp4 plasmid pcmv kan neo msdpp4/product/OriGene Average 99 stars, based on 1 article reviews
untagged mouse ms dpp4 plasmid pcmv kan neo msdpp4 - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
hdpp4 dna copy numbers ![]() Hdpp4 Dna Copy Numbers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hdpp4 dna copy numbers/product/Thermo Fisher Average 99 stars, based on 1 article reviews
hdpp4 dna copy numbers - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
GenScript corporation
human dpp4 complementary dna (cdna) ![]() Human Dpp4 Complementary Dna (Cdna), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human dpp4 complementary dna (cdna)/product/GenScript corporation Average 90 stars, based on 1 article reviews
human dpp4 complementary dna (cdna) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Expression Systems Inc
insect sf9 cells soluble human dpp4 ![]() Insect Sf9 Cells Soluble Human Dpp4, supplied by Expression Systems Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/insect sf9 cells soluble human dpp4/product/Expression Systems Inc Average 99 stars, based on 1 article reviews
insect sf9 cells soluble human dpp4 - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Sino Biological
pcmv3 0 cdna plasmids ![]() Pcmv3 0 Cdna Plasmids, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcmv3 0 cdna plasmids/product/Sino Biological Average 92 stars, based on 1 article reviews
pcmv3 0 cdna plasmids - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
GenScript corporation
full-length genes of sars-cov spike ![]() Full Length Genes Of Sars Cov Spike, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/full-length genes of sars-cov spike/product/GenScript corporation Average 90 stars, based on 1 article reviews
full-length genes of sars-cov spike - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Abnova
anti-dpp4 ![]() Anti Dpp4, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-dpp4/product/Abnova Average 90 stars, based on 1 article reviews
anti-dpp4 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
OriGene
ccaatagttctgctgagcaa ![]() Ccaatagttctgctgagcaa, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ccaatagttctgctgagcaa/product/OriGene Average 96 stars, based on 1 article reviews
ccaatagttctgctgagcaa - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Replication kinetics of MERS-CoV in cell lines of human, nonhuman primate, hamster, mouse, and ferret origin. (A) Huh-7 (red circles), Vero (red squares), BHK (blue circles), 3T3 (blue squares), MEF C57Bl6 (blue triangles), and primary ferret (blue inverted triangles) cell lines were inoculated with MERS-CoV using an MOI of 0.01 TCID50/cell. Supernatants were harvested at 0, 24, 48, and 72 h postinoculation (hpi), and viral titers were determined by endpoint titration in quadruplicate in VeroE6 cells. Red lines indicate cell lines originating from species known to be susceptible to MERS-CoV infection; blue lines indicate cell lines originating from species nonsusceptible to MERS-CoV infection. (B) Western blots of cellular lysates of Huh-7, Vero, BHK, primary ferret, 3T3, and MEF C57Bl6 cells probed with anti-DPP4 or anti-actin antibodies. (C) Cells were stained using anti-DPP4 (R&D) and an FITC-conjugated secondary antibody (Life Technologies). Samples were collected using an LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo and GraphPad software. Mean titers were calculated from three independent experiments. Error bars indicate standard deviations.
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Titration, Infection, Western Blot, Staining, Flow Cytometry, Software
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: DPP4 in rhesus macaque, hamster, mouse, and ferret lung and kidney tissues. IHC was performed on lung and kidney tissues from rhesus macaque, hamster, mouse, and ferret tissues using an anti-DPP4 antibody. Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin. IHC images, lung: closed arrow, bronchiolar epithelium; open arrow, smooth muscle; asterisk, alveolar macrophage; closed arrowhead, alveolar interstitium. IHC images, kidney: closed arrow, renal tubular epithelium; open arrow, glomerular endothelium (magnification, ×200).
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques:
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: DPP4 expression in lung and kidney tissues of different mammalian species
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Expressing
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Replication kinetics of MERS-CoV on hamster and ferret cell lines expressing human, hamster, or ferret DPP4. (A) Human DPP4 (red), hamster DPP4 (blue), ferret DPP4 (blue), and GFP (green) were expressed in BHK (circles) or primary ferret (squares) cells. Twenty-four hours posttransfection, cells were inoculated with MERS-CoV using an MOI of 1 TCID50/cell. Supernatants were harvested at 0, 24, 48, and 72 hpi, and viral titers were determined by endpoint titration in quadruplicate in VeroE6 cells. Mean titers were calculated from three independent experiments. Error bars indicate standard deviations. (B) BHK or primary ferret cells were left untransfected (red) or transfected with DPP4 (blue) and stained 24 h posttransfection using anti-DPP4 (R&D) and an FITC-conjugated secondary antibody (Life Technologies). Samples were collected using an LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo software. (C) Expression of DPP4 mRNA was measured via qRT-PCR. Relative fold increase was calculated by the comparative CT method (35), where DPP4 expression is normalized to HPRT.
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Expressing, Titration, Transfection, Staining, Flow Cytometry, Software, Quantitative RT-PCR
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Replication kinetics of MERS-CoV on BHK cells expressing DPP4 of livestock species. Camel (green circles), cow (green squares), goat (green triangles), or sheep (green inverted triangles) DPP4 and rhesus macaque (red squares), ferret (blue squares), or mouse (blue triangles) DPP4 were expressed on BHK cells. As a control, human (red) or hamster (blue) DPP4 was expressed on BHK cells. Twenty-four hours posttransfection, cells were inoculated with MERS-CoV using an MOI of 1 TCID50/cell. Supernatants were harvested at 0, 24, 48, and 72 hpi, and viral titers were determined by endpoint titration in quadruplicate in VeroE6 cells. Mean titers were calculated from three independent experiments. Error bars indicate standard deviations. (B) BHK cells were left untransfected (red) or transfected with DPP4 (blue) and stained 24 h posttransfection using anti-DPP4 (R&D) and an FITC-conjugated secondary antibody (Life Technologies). Samples were collected using an LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo software. (C) Expression of DPP4 mRNA was measured via qRT-PCR. Relative fold increase was calculated by the comparative CT method (35), where DPP4 expression is normalized to HPRT.
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Expressing, Titration, Transfection, Staining, Flow Cytometry, Software, Quantitative RT-PCR
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Alignment of DPP4 amino acid residues of different mammalian species interacting with the MERS-CoV spike protein a
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques:
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Interaction between MERS-CoV spike protein and DPP4s of different mammalian species. (A) Cartoon representing the binding between human DPP4 or hamster DPP4 and the spike protein of MERS-CoV. DPP4 is depicted in white; the receptor binding domain (RBD) of the spike protein of MERS-CoV is depicted in magenta and cyan. The far right panel is obtained by clockwise rotation of the middle panel along a longitudinal axis. (B) Binding energies between spike protein of MERS-CoV and DPP4 of different species as well as humanized hamster DPP4 and hamsterized human DPP4. Red bars indicate the binding energies of known binders (human and rhesus macaque DPP4), blue bars indicate the binding energies of nonbinders (hamster, mouse, and ferret DPP4), green bars indicate the binding energies of unknown binders (dromedary camel, goat, cow, and sheep), and purple bars indicate the binding energies of the in silico mutagenized hamster and human DPP4s. The DPP4 homology models were constructed using the human DPP4 structure (PDB ID 4KR0, chain A) as a template and subjected to the binding energy calculation using an all-atom distance-dependent pairwise statistical potential, DFIRE.
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Binding Assay, In Silico, Construct
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Replication kinetics of MERS-CoV on BHK cells expressing mutagenized DPP4s. (A) Humanized hamster DPP4 (blue circles) or hamsterized human DPP4 (red squares) was expressed on BHK cells. As a control, human DPP4 (red circles) was expressed on BHK cells. Twenty-four hours posttransfection, cells were inoculated with MERS-CoV using an MOI of 1 TCID50/cell. Supernatants were harvested at 0, 24, 48, and 72 hpi, and viral titers were determined by endpoint titration in quadruplicate in VeroE6 cells. Mean titers were calculated from three independent experiments. Error bars indicate standard deviations. (B) BHK cells were left untransfected (red) or transfected with DPP4 (blue) and stained 24 h posttransfection using anti-DPP4 (R&D) and an FITC-conjugated secondary antibody (Life Technologies). Samples were collected using an LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo software.
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques: Expressing, Titration, Transfection, Staining, Flow Cytometry, Software
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: DPP4 in camel, goat, cow, and sheep lung and kidney tissue. IHC was performed on lung and kidney tissues from camel, goat, cow, and sheep using an anti-DPP4 antibody. Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin. IHC images, lung: closed arrow, bronchiolar epithelium; open arrow, smooth muscle; asterisk, alveolar macrophage; closed arrowhead, alveolar interstitium. IHC images, kidney: closed arrow, renal tubular epithelium; open arrow, glomerular endothelium (magnification, ×200).
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques:
Journal: Journal of Virology
Article Title: Host Species Restriction of Middle East Respiratory Syndrome Coronavirus through Its Receptor, Dipeptidyl Peptidase 4
doi: 10.1128/JVI.00676-14
Figure Lengend Snippet: Percent identity between DPP4 protein sequences
Article Snippet: Human and hamster DPP4s in pcDNA3.1(+) were restriction digested, purified, and ligated with the humanized hamster or hamsterized
Techniques:
Journal: Virology
Article Title: Lipidation increases antiviral activities of coronavirus fusion-inhibiting peptides
doi: 10.1016/j.virol.2017.07.033
Figure Lengend Snippet: Effects of cell-surface proteases on HR2 peptide antiviral activities. (A) Calu3 and Vero81 cells were incubated with MERS pps in the presence of increasing concentrations of HR2 peptides. (B) Total cellular RNA was isolated from Calu3and Vero81 cells, and evaluated for the expression of DPP4, TMPRSS2, furin, cathepsin L (Cat. L) and hypoxanthine-guanine phosphoribosyltransferase (HPRT) transcripts by reverse transcription – quantitative PCR. Expression levels were plotted relative to HPRT expression levels. ND = Not Detected. (C) Calu3 and Vero81 cells were transduced with MERS pps in the presence of increasing concentrations of HR2 peptide or camostat (Camo). Camo was present from 1 h pre-transduction and HR2 was present at the time of MERS pp inoculation. (D) Calu3 cells were incubated with or without 10 μM camostat (Camo) for 1 h, then transduced with MERS pps in the presence of increasing concentrations of HR2 peptide. (E) Vero81 cells were transfected with either TMPRSS2 or vector control plasmids. At 2 d post-transfection, cells were transduced with MERS pps in the presence of increasing concentrations of HR2 peptide. For (A), (C), (D) and (E), unbound MERS pps and entry inhibitors were removed at 1 h post-transduction. Virus entry was quantified by measuring luciferase levels at 48 h post-transduction and data were normalized to control conditions lacking inhibitors. Error bars present SD from the mean (n = 3). Statistical significance was assessed by student's t -test. ***, P < 0.001.
Article Snippet: Plasmid encoding C-terminal flag-tagged
Techniques: Incubation, Isolation, Expressing, Real-time Polymerase Chain Reaction, Transduction, Transfection, Plasmid Preparation, Luciferase
Journal: Virology
Article Title: Lipidation increases antiviral activities of coronavirus fusion-inhibiting peptides
doi: 10.1016/j.virol.2017.07.033
Figure Lengend Snippet: Primers for real-time PCR.
Article Snippet: Plasmid encoding C-terminal flag-tagged
Techniques:
Journal: PLoS ONE
Article Title: Multi-Organ Damage in Human Dipeptidyl Peptidase 4 Transgenic Mice Infected with Middle East Respiratory Syndrome-Coronavirus
doi: 10.1371/journal.pone.0145561
Figure Lengend Snippet: (A) Schematic diagram of the optimized hDPP4 expression vector cassette. The optimized hDPP4 was cloned into a pCAGGS plasmid in which hDPP4 expression was driven by the CAG promoter. hDPP4 expression was confirmed in vitro by transfection of Cos-7 cells with the pCAGGS-hDPP4 (B) or pCAGGS (C) plasmids and detected by direct immunofluorescence assay with FITC-labeled anti-human CD26–Fluorescein antibody. Confirmation of the binding between DPP4 and MERS-CoV RBD was achieved by transfecting Cos-7 cells with pCAGGS-hDPP4 (D) or pCAGGS (E) plasmid followed by indirect immunofluorescence assay with MERS-RBD-Fc protein and DyLight 549-conjugated goat anti-human IgG antibody. (F) Determination of the copy numbers of hDPP4 cDNA in four transgenic founder lines by qPCR. (G) Expression of hDPP4 mRNA in the indicated tissues of transgenic mice in two founder lines as determined by qRT-PCR. Results are mean±SEM ( n = 3). (H) Four lines of hDPP4 transgenic mice were infected with MERS-CoV and monitored for body weight changes. Results are mean±SEM ( n = 6). (I) Lung viral titer at day 5 postinfection was determined for four lines of hDPP4 transgenic mice. The data are expressed as mean±SEM ( n = 3). The dotted line indicates the limit of detection.
Article Snippet: The
Techniques: Expressing, Plasmid Preparation, Clone Assay, In Vitro, Transfection, Immunofluorescence, Labeling, Binding Assay, Transgenic Assay, Quantitative RT-PCR, Infection
Journal: PLoS ONE
Article Title: Multi-Organ Damage in Human Dipeptidyl Peptidase 4 Transgenic Mice Infected with Middle East Respiratory Syndrome-Coronavirus
doi: 10.1371/journal.pone.0145561
Figure Lengend Snippet: The hDPP4 transgenic mice were infected intranasally with MERS-CoV. Lungs, kidneys, liver, spleen and brain were collected on day 5 or day 9 after MERS-CoV infection, fixed in neutral formaldehyde solution and stained with hematoxylin and eosin. Histopathological analysis of hDPP4 transgenic mice was performed using sham-infected mice as controls (A, D, G, J). (B-C) In the lungs, mild inflammation was observed, with inflammatory cell infiltration (arrowheads) and focal hemorrhage and exudation (arrow) on day 5. Damage was more severe on day 9, with increased inflammatory cell infiltration, focal hemorrhage (inset) and exudation. (E-F) In the kidney, MERS-CoV-infected hDPP4 transgenic mice showed focal interstitial inflammation with inflammatory cell infiltration in the interstitium and exudates in renal tubules (arrow) on day 5. On day 9, degeneration and necrosis in the renal tubular epithelial cells (inset) and focal hemorrhage were observed. (H-I) In the liver, MERS-CoV-infected hDPP4 transgenic mice showed scattered hepatocyte necrosis and numerous activated kupffer cells and infiltrated macrophages in the hepatic sinusoid on day 5. Fatty change of hepatocytes (inset) was observed in the liver on day 9. (K-L) In the spleen, necrotic splenic cells and increased reticulum cells in the red pulp with significant amounts of hemosiderin deposition were observed in hDPP4 transgenic mice on days 5 and 9 (arrow and inset). (M-O) Neurological damage with perivascular cuffs (M) and neuronal cell necrosis in the cerebral cortex (N) including damaged neurons (inset) in the hippocampus (O) was observed in the brains of hDPP4 transgenic mice infected with MERS-CoV. ( n = 2, scale bars = 50 μm).
Article Snippet: The
Techniques: Transgenic Assay, Infection, Staining
Journal: PLoS ONE
Article Title: Multi-Organ Damage in Human Dipeptidyl Peptidase 4 Transgenic Mice Infected with Middle East Respiratory Syndrome-Coronavirus
doi: 10.1371/journal.pone.0145561
Figure Lengend Snippet: Transgenic mice were infected intranasally with MERS-CoV and sacrificed to access the expression of viral antigens by immunohistochemical staining ( n = 2). No viral antigens were detected in the sham-infected mice (A, D, G), but viral antigens were detected in type I and type II pneumocytes and infiltrated macrophages in the lungs (B-C), renal tubular epithelial cells in the kidneys (E-F), and neuron cell bodies as well as in dendrites and axons in the brain (H-I), including the hippocampus (I). (J) Viral load was detected by qRT-PCR and expressed as viral RNA copies/g of tissues. The detection limit shown as dotted line is 1×10 3 copies/g. Results are mean±SEM ( n = 2). (K) Viral titers in tissues of infected hDPP4 transgenic mice were determined by CPE-based assay and expressed as Log 10 TCID 50 /g of tissues. Results are mean±SEM ( n = 5). The dotted line indicates the detection limit.
Article Snippet: The
Techniques: Transgenic Assay, Infection, Expressing, Immunohistochemical staining, Staining, Quantitative RT-PCR
Journal: Molecules
Article Title: A Novel Purification Procedure for Active Recombinant Human DPP4 and the Inability of DPP4 to Bind SARS-CoV-2
doi: 10.3390/molecules25225392
Figure Lengend Snippet: Figure 1. Overview of DPP4 purification workflow.
Article Snippet: Expression of DPP4 in
Techniques:
Journal: Molecules
Article Title: A Novel Purification Procedure for Active Recombinant Human DPP4 and the Inability of DPP4 to Bind SARS-CoV-2
doi: 10.3390/molecules25225392
Figure Lengend Snippet: Figure 2. Elution profiles of DPP4 chromatography. (A) Chromatogram from Phenyl Sepharose that was equilibrated with 12% ammonium sulphate (AS) in 10 mM Tris-HCl pH 7.6 and eluted with 0% AS in 10 mM Tris-HCl pH 7.6 buffer. Inset: Fibroblast activation protein (FAP) activity. (B) Chromatogram from Nickel Sepharose, which was equilibrated with 20 mM imidazole in 200 mM NaCl, 10 mM Tris-HCl, pH 7.6 and eluted with an increasing concentration gradient of imidazole at 30 mM (a), 100 mM (b), 500 mM (c), 1000 mM (d) in 10 mM Tris-HCl pH 7.6 buffer. Inset: FAP activity. (C) Chromatogram from DEAE Sepharose that was equilibrated with 10 mM Tris-HCl pH 7.6 and eluted with 200 mM NaCl in 10 mM Tris-HCl pH 7.6 buffer. Inset: sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS–PAGE; 4–12% Bis-Tris gel) of the resulting purified soluble DPP4, stained with Sypro ruby Protein was measured by optical density at 280 nm in these chromatograms.
Article Snippet: Expression of DPP4 in
Techniques: Chromatography, Activation Assay, Activity Assay, Concentration Assay, Polyacrylamide Gel Electrophoresis, SDS Page, Staining
Journal: Molecules
Article Title: A Novel Purification Procedure for Active Recombinant Human DPP4 and the Inability of DPP4 to Bind SARS-CoV-2
doi: 10.3390/molecules25225392
Figure Lengend Snippet: Figure 3. ELISA and virus neutralisation assays. (A) Purified DPP4 protein was used to capture MERS-CoV spike clamp, SARS-CoV-2 spike clamp or a control clamped protein. Clamp-stabilised proteins were detected using a clamp-specific mAb HIV1281. Data shown represent means of duplicate values. (B) DPP4, ACE2, a MERS-specific mAb m336 or a non-specific mAb C05 were used at 20 µg/mL and incubated with MERS-CoV pseudovirus. Percent MERS-CoV inhibition is the percentage reduction in luciferase signal (RLU) compared to virus-only control. N.D. indicates no inhibition detected. Data shown are the mean of duplicate values with error bars representing SD.
Article Snippet: Expression of DPP4 in
Techniques: Enzyme-linked Immunosorbent Assay, Virus, Control, Incubation, Inhibition, Luciferase
Journal: Molecules
Article Title: A Novel Purification Procedure for Active Recombinant Human DPP4 and the Inability of DPP4 to Bind SARS-CoV-2
doi: 10.3390/molecules25225392
Figure Lengend Snippet: Figure 4. Surface plasmon resonance assays. Purified soluble human ACE2 (A) and DPP4 (B) were exposed to CM5 chips that had been coated with SARS-CoV-2 RBD or spike protein, or were not coated. Experimental data are shown in red. Calculated data fit using a 1:1 binding model are shown in black. Ligands were injected at increasing concentrations of (A) ACE2 at 0.50 nM, 2.5 nM, 12 nM, 62 nM and 310 nM and (B) DPP4 at 1.6 nM, 8.0 nM, 40 nM, 200 nM and 1000 nM.
Article Snippet: Expression of DPP4 in
Techniques: SPR Assay, Binding Assay, Injection
Journal: Molecules
Article Title: A Novel Purification Procedure for Active Recombinant Human DPP4 and the Inability of DPP4 to Bind SARS-CoV-2
doi: 10.3390/molecules25225392
Figure Lengend Snippet: Figure 5. Protein structures. (A) DPP4 monomer (PDB ID 1W1I) [46]. (B) Adenosine Deaminase
Article Snippet: Expression of DPP4 in
Techniques:
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Part ( A ) Time course of DPP4 expression was measured by RT PCR during differentiation. CP values were normalized to the housekeeping gene GAPDH, and are presented relative to Day 0. The left y-axis shows the original ΔCP values, and the calculated fold change vs. Day 0 is displayed on the right y-axis. Data are displayed as mean values ± SEM, n = 4. Part ( B ) DPP4 expression was measured by Real Time PCR in different human tissues (RNA Panel from Clontech, Mountain View, CA, USA), normalized to the housekeeping gene GAPDH, and is presented as mean fold change values + SEM, n ≥ 2, in a logarithmic scale. Part ( C ) DPP4 protein levels during differentiation were analyzed by Western blotting followed by densitometric quantification. The upper panel shows a representative blot, which was cropped for clarity. The full gel is shown in . For quantification, at least three blots per time point were used. Densitometric data were normalized to α-actinin and are displayed relative to Day 0 in the lower panel as mean values + SEM. Part ( D ) DPP4 release during differentiation was assessed by ELISA. Data are represented relative to Day 0 as mean values ± SEM (full line), n = 5. Statistical evaluation was done by regression analysis, **p < 0.01. The regression line is shown dashed. Part ( E ) Effect of lipolysis, induced by forskolin (10 μM, “F”) or DBcAMP (100 μM, “cAMP”) on the liberation of DPP4 and leptin into the cell culture supernatants over 24 hours. Data are presented relative to untreated control as mean values ± SEM, n ≥ 4. Statistical analysis was done by one sample t test; **p < 0.01 vs. control. Part ( F ) Presence of DPP4 in different cell fractions as indicated was analyzed by Western blotting after cell fractionation; the blot was cropped for clarity; the whole gel is shown in . Part ( G ) Microscopic images (40x) showing immunofluorescence staining of DPP4 (green) to determine its subcellular localization. The cytoskeleton (F-actin) is labeled in red.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Culture, Control, Cell Fractionation, Immunofluorescence, Staining, Labeling
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Human preadipocytes were stably transduced with shRNA constructs directed against DPP4 mRNA by lentiviral vectors. Unspecific, non-target shRNA was used as a negative control (labeled “SHc” in the figure). Knockdown (KD) of DPP4 expression was confirmed on mRNA Part ( A ) and protein Part ( B ) level by quantitative Real Time PCR and Western blotting, respectively. The picture of the Western blot was cropped for clarity. The entire lanes are shown in . PCR data are presented as mean ∆CP values (normalized to GAPDH, relative to SHc) ± SEM (left y-axis) and calculated fold change values vs. control (right y-axis), n ≥ 5. Statistical analysis was done by one-way ANOVA with Dunnett post-test; **p < 0.01 vs. negative control. Part ( C ) At least 5-fold changes in gene expression resulting from DPP4 knockdown, measured by whole genome DNA array hybridization, are visualized in a heat plot. Hybridization was performed in two-color mode; each line represents the difference between a DPP4 knockdown and sh-control sample. The four lines represent four biological replicates. Up-regulated genes in DPP4 knockdown compared to control are marked in green, down-regulated genes in red. The color intensity indicates the expression level of the respective gene. Part ( D ) Changes in the expression of two representative genes (PPARγC1α and PDK4) over time after infection were followed by quantitative PCR. Data represent mean ∆CP values (vs. GAPDH) ± SEM (left y-axis) and calculated fold change values vs. control (SHc at Day 0) on the right y-axis, n ≥ 3. Statistical analysis was done by t test; *p < 0.05; **p < 0.01 vs. control. Part ( E ) shows a Western blot confirming the up-regulation of PPARγ1Cα on protein level when DPP4 is suppressed. The blot was cropped for clarity. The entire lanes are shown in . The results for DPP4, PPARγ1Cα and the loading control α-actinin from cells infected with sh-control vector (“SHc”) and sh-DPP4 vector (“DPP4 KD”), respectively, are shown as indicated in the figure.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: Stable Transfection, Transduction, shRNA, Construct, Negative Control, Labeling, Knockdown, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Control, DNA Array, Hybridization, Infection, Plasmid Preparation
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Effects of DPP4 gene expression knockdown in human primary preadipocytes.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: Expressing, Knockdown, Binding Assay, Membrane, Migration, Transduction, Cell Surface Receptor Assay
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Part ( A ) Human preadipocytes were stable transduced by lentiviral shRNA constructs against DPP4 or were incubated with a PPARγ agonist (pioglitazone, 10 μM) for 3 days. Incubation of DPP4 knockdown cells with a PPARγ inhibitor (T0070907, 10 μM) is shown on the right. Expression of representative genes was analyzed by quantitative Real Time PCR. Values were normalized to the housekeeping gene GAPDH, and are presented relative to control cells infected with non-targeting shRNA. The left y-axis shows the original ΔCP values, and the calculated fold change vs. Day 0 is displayed on the right y-axis. Part ( B ) shows Oil Red O staining of lipids (red) in human preadipocytes after DPP4 knockdown (“DPP4 KD”, mid panel) or after treatment with pioglitazone (10 μM, right panel) for 10 days. Exemplary lipid vacuoles are marked by arrows. Control cells treated with non-targeting shRNA are shown in the left panel. Part ( C ) Gene expression was measured by RT PCR in human preadipocytes after lentiviral transduction with a shRNA construct against PPARγ (“PPARγ KD”) or after treatment with the PPARγ inhibitor T0070907. Representation of data is the same as in Part ( A ). In Parts ( A ) and ( C ), bars represent mean values + SEM, n ≥ 4, Statistical analysis was done by one-way ANOVA with Dunnett post-test; *p < 0.05; **p < 0.01; ***p < 0.001 vs. control.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: shRNA, Construct, Incubation, Knockdown, Expressing, Real-time Polymerase Chain Reaction, Control, Infection, Staining, Reverse Transcription Polymerase Chain Reaction, Transduction
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Human preadipocytes were stable transduced by lentiviral shRNA constructs against DPP4; infected cells were selected with puromycin and differentiated for up to 12 days. Gene expression was measured by Real Time PCR and was normalized to the housekeeping gene GAPDH. Full lines represent the time course of gene expression during differentiation in DPP4 knockdown (“DPP4 KD”) cells, broken lines refer to cells transduced with non-targeting shRNA (sh-control, “SHc”). Data are displayed as mean ∆CP values ± SEM (left y-axis). For better understanding, calculated values of fold change vs. control (SHc at Day 0) are indicated on the right y-axis. Statistical analysis (n ≥ 3) was done by t test; *p < 0.05; ***p < 0.001 vs. control.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: shRNA, Construct, Infection, Expressing, Real-time Polymerase Chain Reaction, Knockdown, Transduction, Control
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Human preadipocytes were transduced by lentiviral shRNA directed against DPP4 (labeled “DPP4-KD” in the figure) or, as control, by non-targeting shRNA (labeled “SHc” in the figure. Part ( A ) Activation of signaling pathways was analyzed by Western blotting with antibodies directed against the phosphorylated (active) form of the respective signaling protein, pERK (phospho-Extracellular-signal Regulated Kinase) or pAkt (phospho-Akt1). The effect of DPP4 knockdown on insulin (ins) signaling via the pAkt and the pERK pathway is shown. The insulin concentration used was 100 nM, incubation time was 10 min. Detection of α-actinin served as loading control. Insulin receptor expression was also detected in the preadipocytes (lower panel of Part A) and was not affected by treatment. The blots were cropped for clarity. Uncropped pictures are shown in . The densitometric quantification of the phosphoproteins is shown in Part ( B ). Statistical analysis was done by one-way ANOVA with Dunnett post-test; *p < 0.05; **p < 0.01 vs. insulin-treated sh-control (SHc). Part ( C ) Proliferation of the preadipocytes after DPP4 knockdown vs. SHc was assessed by cell counting at various time points as indicated.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: shRNA, Labeling, Control, Activation Assay, Western Blot, Knockdown, Concentration Assay, Incubation, Expressing, Cell Counting
Journal: Scientific Reports
Article Title: Metabolic role of dipeptidyl peptidase 4 (DPP4) in primary human (pre)adipocytes
doi: 10.1038/srep23074
Figure Lengend Snippet: Nucleotide sequences of the PCR primers used.
Article Snippet: Cells were washed in PBS and fixed with 4% paraformaldehyde at 4 °C for 1 h. Blocking was done in a 0,1% BSA solution (Sigma-Aldrich, Steinheim, Germany) for 1 h. The incubation with primary
Techniques: